
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 설계로 강력한 miRNA 억제 제공. 다양한 세포에 효율적 전달 가능. 장기적 억제 효과 유지. 퓨로마이신 저항성 유전자 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-698-5p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGUGGGUGGGACAGGGAUGUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0022930 |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to enable potent inhibition of target miRNA.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- 퓨로마이신 저항성 유전자 포함으로 선택적 세포 배양 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



