Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-496a-3p

디자인

• Tough Decoy (TuD) 기반 설계

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UGAGUAUUACAUGGCCAAUCUC

Sanger 성숙/소수 수납 번호

• MIMAT0003738

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, developed based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective inhibition of target miRNA.

miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, upon co-transfection with compatible packaging plasmids, produces viral particles suitable for mammalian cell transduction.

The vector includes:

• Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
• Puromycin resistance gene for selection of successfully transduced cells

주요 특징

• 강력한 miRNA 억제 효과
• 렌티바이러스 전달 형식으로 다양한 세포에 효율적 적용
• 반복적인 트랜스펙션 없이 장기적 억제 가능
• 안정적 발현 및 선택 가능 (puromycin resistance 포함)