CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-496a-3p 억제를 위한 Tough Decoy 기반 렌티바이러스형 miRNA inhibitor TRC2-pLKO-puro vector에 클로닝되어 다양한 세포에 효율적 전달 가능 Puromycin 선택 마커 및 WPRE 포함으로 안정적 발현 유도 장기적인 miRNA 억제 효과 제공 농도 ≥1x10⁶ VP/ml, -70°C 보관

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0360 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

  • mmu-miR-496a-3p

디자인

  • Tough Decoy (TuD) 기반 설계

품질 등급

제품 라인

  • MISSION®

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • UGAGUAUUACAUGGCCAAUCUC

Sanger 성숙/소수 수납 번호

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, developed based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective inhibition of target miRNA.

miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, upon co-transfection with compatible packaging plasmids, produces viral particles suitable for mammalian cell transduction.

The vector includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
  • Puromycin resistance gene for selection of successfully transduced cells

주요 특징

  • 강력한 miRNA 억제 효과
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 적용
  • 반복적인 트랜스펙션 없이 장기적 억제 가능
  • 안정적 발현 및 선택 가능 (puromycin resistance 포함)

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.