
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA를 강력하게 억제하는 Lentiviral 기반 TuD 디자인 제품입니다. 다양한 세포에 효율적으로 전달 가능하며, 장기적인 억제 효과를 제공합니다. Puromycin 선택 마커와 WPRE 요소 포함으로 안정적 발현을 지원합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1186a
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GAGUGCUGGAAUUAAAGGCAUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0005836 |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- Lentiviral 기반 전달로 다양한 세포 유형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기 억제 가능
- Puromycin 선택 마커 및 WPRE 요소 포함으로 안정적 발현 지원
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



