CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA를 강력하게 억제하는 Lentiviral 기반 TuD 디자인 제품입니다. 다양한 세포에 효율적으로 전달 가능하며, 장기적인 억제 효과를 제공합니다. Puromycin 선택 마커와 WPRE 요소 포함으로 안정적 발현을 지원합니다.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0063 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-1186a

Tough Decoy (TuD) Design


제품 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 GAGUGCUGGAAUUAAAGGCAUG
Sanger 성숙/소수 수납 번호 MIMAT0005836
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.


주요 특징

  • 강력한 miRNA 억제 효과 제공
  • Lentiviral 기반 전달로 다양한 세포 유형에 효율적 적용
  • 반복적인 트랜스펙션 없이 장기 억제 가능
  • Puromycin 선택 마커 및 WPRE 요소 포함으로 안정적 발현 지원

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.