
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 입자. miRBase 기반 성숙 서열을 사용하며, TRC2-pLKO-puro 벡터에 클로닝되어 정확한 Dicer 처리 구조를 유지. EF1A 프로모터로 발현 유도, 푸로마이신 내성 유전자 포함, 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-7706
제품 개요
Sigma의 MISSION® Lenti-miRs는 공통 백본 구조를 기반으로 하여 정확한 Dicer 처리를 보장하도록 설계된 microRNA 발현용 렌티바이러스 입자입니다. 각 miRNA는 miRBase에서 확보된 성숙 서열을 기반으로 TRC2-pLKO-puro 벡터에 클로닝 및 서열 검증되어 제공됩니다.
주요 특징
- TRC2-pLKO-puro 벡터 기반 클로닝 및 서열 검증 완료
- EF1A 프로모터를 이용한 안정적 발현
- 푸로마이신 내성 유전자 포함
- 분화된 세포 및 비분열 세포(예: 뉴런, 수지상세포)에도 감염 가능
- 건빙(dry ice) 상태로 배송, −70°C 보관
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGAAGCGCCUGUGCUCUGCCGAGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0030021 |
| microRNA 수납 번호 | MI0025242 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
기술 설명
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), drives miRNA expression for reverse transcription and integration into the host genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression. This lentiviral vector also carries a puromycin resistance gene for cell selection. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration into both differentiated and non-dividing cells.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



