CacheBy
Merck MISSION Lenti microRNA, Human
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Human

상품 한눈에 보기

인간 microRNA 발현용 렌티바이러스 입자. miRBase 기반 성숙 서열을 사용하며, TRC2-pLKO-puro 벡터에 클로닝되어 정확한 Dicer 처리 구조를 유지. EF1A 프로모터로 발현 유도, 푸로마이신 내성 유전자 포함, 건빙 상태로 배송.

브랜드
Merck Sigma
카테고리
Other Organics

Merck Sigma · Merck MISSION Lenti microRNA, Human

MISSION® Lenti microRNA, Human

hsa-miR-7706


제품 개요

Sigma의 MISSION® Lenti-miRs는 공통 백본 구조를 기반으로 하여 정확한 Dicer 처리를 보장하도록 설계된 microRNA 발현용 렌티바이러스 입자입니다. 각 miRNA는 miRBase에서 확보된 성숙 서열을 기반으로 TRC2-pLKO-puro 벡터에 클로닝 및 서열 검증되어 제공됩니다.


주요 특징

  • TRC2-pLKO-puro 벡터 기반 클로닝 및 서열 검증 완료
  • EF1A 프로모터를 이용한 안정적 발현
  • 푸로마이신 내성 유전자 포함
  • 분화된 세포 및 비분열 세포(예: 뉴런, 수지상세포)에도 감염 가능
  • 건빙(dry ice) 상태로 배송, −70°C 보관

제품 사양

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 UGAAGCGCCUGUGCUCUGCCGAGA
Sanger 성숙/소수 수납 번호 MIMAT0030021
microRNA 수납 번호 MI0025242
배송 상태 Dry ice
저장 온도 −70°C

기술 설명

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), drives miRNA expression for reverse transcription and integration into the host genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression. This lentiviral vector also carries a puromycin resistance gene for cell selection. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration into both differentiated and non-dividing cells.

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.