
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 기반으로 설계됨. TRC2-pLKO-puro 벡터 사용 및 서열 검증 완료. 비분열 세포에도 효율적 감염 가능. −70°C에서 건빙 배송.
- 브랜드
- Merck Sigma
- 카테고리
- Vectors
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-1203
제품 개요
Sigma의 MISSION Lenti-miRs는 공통 백본 구조를 기반으로 miRNA를 발현하며, 정확한 Dicer 처리를 위한 구조적 요구사항을 충족합니다. 부분 상보적 가닥은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.
Polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allows for enhanced expression of transgenes delivered by lentiviral vectors.
이 렌티바이러스 벡터는 퓨로마이신 내성 유전자를 포함하여 세포 선택이 가능하며, MMLV 또는 MSCV 기반 레트로바이러스 시스템과 달리 신경세포 및 수지상세포와 같은 비분열 세포에도 효율적으로 감염 및 통합됩니다.
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CCCGGAGCCAGGAUGCAGCUC |
| 성숙/소수 수납 번호 | MIMAT0005866 |
| microRNA 수납 번호 | MI0006335 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



