
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2Merck MISSION Lenti microRNA, Human
상품 한눈에 보기
인간 microRNA hsa-miR-17-3p를 발현하는 렌티바이러스 기반 벡터 시약으로, 정확한 Dicer 처리 구조를 갖춘 TRC2-pLKO-puro 벡터에 클로닝됨. EF1A 프로모터로 발현되며, 퓨로마이신 선택 가능. 건빙 상태 배송, −70°C 보관.
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-17-3p
제품 개요
Sigma의 MISSION Lenti-miRs는 공통 백본 구조에서 microRNA를 발현하는 렌티바이러스 기반 시스템으로, 정확한 Dicer 처리 요구사항을 충족하도록 설계되었습니다. 부분 상보 서열은 백본 구조의 염기쌍 패턴을 모사하도록 독자적인 알고리즘으로 디자인되었습니다.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.
주요 특징
- Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
- Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
- EF1A polymerase II promoter drives miRNA expression for efficient reverse transcription and integration.
- Includes Woodchuck Hepatitis Post-Transcriptional Regulatory element for enhanced transgene expression.
- Carries puromycin resistance gene for cell selection.
- Enables infection and integration in differentiated and non-dividing cells (e.g., neurons, dendritic cells).
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACUGCAGUGAAGGCACUUGUAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0000071 |
| microRNA 수납 번호 | MI0000071 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



