
Merck MISSION Lenti microRNA, Mouse
마우스 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 갖춘 공통 백본 기반. TRC2-pLKO-puro 벡터 사용, 서열 검증 완료. 비분열 세포 포함 다양한 세포에 효율적 감염 및 통합 가능. −70°C에서 건빙 상태로 배송.
- 카탈로그번호
- MLMIR0144
- 브랜드
- Merck Sigma
- 카테고리
- Vectors
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA, Mouse
MISSION® Lenti microRNA, Mouse
mmu-miR-294-3p
제품 개요
Merck Sigma의 MISSION® Lenti microRNA는 공통 백본 구조를 기반으로 설계되어 정확한 Dicer 처리를 지원합니다. TRC2-pLKO-puro 벡터에 microRNA 서열을 클로닝하고, 각 구성체는 서열 검증을 거쳤습니다. 이 렌티바이러스 입자는 분화된 세포와 비분열 세포(예: 뉴런, 수지상세포)에도 효율적으로 감염 및 통합됩니다.
제품 특징
- 공통 백본 구조로 Dicer 정확 처리 보장
- TRC2-pLKO-puro 벡터 사용 및 서열 검증 완료
- EF1A 프로모터를 통한 안정적 발현
- puromycin 내성 유전자로 세포 선택 가능
- 비분열 세포에서도 효율적 감염
스펙 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AAAGUGCUUCCCUUUUGUGUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000372 |
| microRNA 수납 번호 | MI0000392 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
추가 설명
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for transducing mammalian cells. EF1A promoter drives miRNA expression, enabling reverse transcription and integration into the host genome. The Woodchuck Hepatitis Post-Transcriptional Regulatory Element enhances transgene expression. Lentiviral system allows efficient infection and integration into differentiated and non-dividing cells, unlike murine-based MMLV or MSCV retroviral systems.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



