CacheBy
Merck MISSION Lenti microRNA, Human
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Human

상품 한눈에 보기

인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 갖춘 MISSION® 백본 기반. TRC2-pLKO-puro 벡터에 클로닝되어 서열 검증 완료. 비분열 세포 포함 다양한 세포 감염 가능. −70°C에서 드라이아이스로 배송.

브랜드
Merck Sigma
카테고리
Vectors

Merck Sigma · Merck MISSION Lenti microRNA, Human

MISSION® Lenti microRNA, Human

hsa-miR-548ba


제품 개요

Sigma의 MISSION® Lenti-miRs는 공통 백본에서 microRNA를 발현하도록 설계된 렌티바이러스 기반 시스템입니다. 이 구조는 정확한 Dicer 처리를 보장하며, 상보적 가닥은 독자적인 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다. 각 miRNA 구성체는 TRC2-pLKO-puro 벡터에 클로닝되어 서열 검증을 거쳤으며, 성숙 microRNA 서열은 miRBase에서 확보되었습니다.


제품 사양

항목 내용
품질 등급 (Quality Level) 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 (Concentration) ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) AAAGGUAACUGUGAUUUUUGCU
Sanger 성숙/소수 수납 번호 MIMAT0031175
microRNA 수납 번호 MI0025747
배송 상태 (Shipping Condition) Dry ice
저장 온도 (Storage Temperature) −70°C

제품 설명

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.

The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) allows for enhanced expression of transgenes delivered by lentiviral vectors.

This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into both differentiated and non-dividing cells, such as neurons and dendritic cells.


제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.