
Merck MISSION Lenti microRNA, Human
인간 유래 microRNA를 발현하는 렌티바이러스 벡터 기반 제품으로, 정확한 Dicer 처리 구조를 갖춘 MISSION® Lenti 시스템 사용. TRC2-pLKO-puro 벡터 기반으로 서열 검증 완료. 비분열 세포 포함 다양한 세포 감염 가능. −70°C에서 보관.
- 브랜드
- Merck Sigma
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-1587
제품 개요
Sigma의 MISSION® Lenti-miRs는 공통 백본에서 microRNA를 발현하도록 설계된 렌티바이러스 기반 시스템입니다.
정확한 Dicer 처리를 위한 구조를 갖추며, 상보적 가닥은 독자적 알고리즘으로 설계되어 microRNA의 안정적 발현을 지원합니다.
각 miRNA 구성체는 TRC2-pLKO-puro 벡터에 클로닝되어 서열 검증이 완료되었습니다.
주요 특징
- TRC2-pLKO-puro 벡터 기반의 서열 검증된 렌티바이러스 입자
- EF1A 프로모터를 통한 안정적 발현
- Puromycin 내성 유전자 포함
- 분열 및 비분열 세포 모두에 감염 가능
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element(WPRE) 포함으로 발현 강화
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UUGGGCUGGGCUGGGUUGGG |
| Sanger 성숙/소수 수납 번호 | MIMAT0019077 |
| microRNA 수납 번호 | MI0016905 |
| 배송 상태 (Shipping Condition) | Dry Ice |
| 저장 온도 (Storage Temperature) | −70°C |
기술 설명
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The EF1A promoter drives miRNA expression for reverse transcription and genomic integration.
WPRE enhances transgene expression, and the puromycin resistance gene allows selection of transduced cells.
Unlike murine-based retroviral systems (MMLV or MSCV), lentiviral particles enable efficient infection and integration in both dividing and non-dividing cells, such as neurons and dendritic cells.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



