
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 벡터로, miRBase 검증 서열 기반 제작. TRC2-pLKO-puro 벡터에 클로닝되어 정확한 Dicer 처리 보장. EF1A 프로모터 구동, 퓨로마이신 내성 유전자 포함. 비분열 세포까지 효율적 감염 가능.
- 브랜드
- Merck Sigma
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-6734-5p
제품 개요
Merck의 MISSION® Lenti microRNA는 인간 microRNA를 발현하도록 설계된 렌티바이러스 기반 시스템입니다.
이 시스템은 정확한 Dicer 처리를 위한 공통 백본 구조를 사용하며, 상보적 가닥은 독자적 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
주요 특징
- miRBase로부터 검증된 성숙 microRNA 서열 사용
- TRC2-pLKO-puro 벡터에 클로닝 및 서열 검증 완료
- EF1A 프로모터에 의해 구동되어 안정적 발현
- 퓨로마이신 내성 유전자 포함으로 선택 가능
- 비분열 세포(예: 뉴런, 수지상세포)에도 효율적 감염 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UUGAGGGGAGAAUGAGGUGGAGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0027369 |
| microRNA 수납 번호 | MI0022579 |
| 배송 상태 (Shipping) | Dry Ice |
| 저장 온도 (Storage Temp.) | −70 °C |
기술 정보
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
EF1A promoter drives miRNA expression, ensuring reverse transcription and integration into the host genome.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression.
This vector includes a puromycin resistance gene for cell selection.
Unlike murine-based MMLV or MSCV systems, lentiviral-based particles enable efficient infection and integration in both dividing and non-dividing cells.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



