CacheBy
Merck MISSION Lenti microRNA, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Mouse

상품 한눈에 보기

마우스 유래 MISSION Lenti microRNA는 정확한 Dicer 처리 구조를 가진 렌티바이러스 기반 miRNA 발현 시스템입니다. TRC2-pLKO-puro 벡터에 클로닝되어 세포 내 안정적 발현이 가능하며, puromycin 선택 마커를 포함합니다. 건빙 상태로 배송되며 −70°C에서 보관합니다.

브랜드
Merck Sigma
카테고리
Vectors
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLMIR0434 MISSION Lenti microRNA, Mouse, pk판매 단위 pk ·
재고 확인 필요
견적요청

Merck Sigma · Merck MISSION Lenti microRNA, Mouse

MISSION® Lenti microRNA, Mouse

mmu-miR-384-3p


제품 개요

Sigma의 MISSION Lenti-miRs는 공통 백본 구조를 사용하여 정확한 Dicer 처리 요건을 충족하도록 설계된 렌티바이러스 기반 microRNA 발현 시스템입니다.
부분 상보적 서열은 특허 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.

Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase. Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.

Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allows enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.


제품 사양

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AUUCCUAGAAAUUGUUCACAAU
Sanger 성숙/소수 수납 번호 MIMAT0001076
microRNA 수납 번호 MI0001146
배송 상태 dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.