CacheBy
Merck MISSION Lenti microRNA, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Mouse

상품 한눈에 보기

마우스 유래 microRNA를 발현하는 Merck MISSION Lenti 시스템. TRC2-pLKO-puro 벡터 기반으로 제작되어 정확한 Dicer 처리 보장. 건빙(dry ice) 배송, −70°C 보관. 비분열 세포에도 효율적 감염 및 통합 가능.

브랜드
Merck Sigma
카테고리
Vectors
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLMIR0467 MISSION Lenti microRNA, Mouse, pk판매 단위 pk ·
재고 확인 필요
견적요청

Merck Sigma · Merck MISSION Lenti microRNA, Mouse

MISSION® Lenti microRNA, Mouse

mmu-miR-450a-5p


제품 개요

Sigma의 MISSION® Lenti-miRs는 공통 백본 구조를 기반으로 miRNA를 발현하며, 정확한 Dicer 처리를 위해 설계되었습니다. 부분 상보적 가닥은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 디자인되었습니다.

Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase. Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.

Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allows for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.


제품 스펙

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 UUUUGCGAUGUGUUCCUAAUAU
Sanger 성숙/소수 수납 번호 MIMAT0001546
microRNA 수납 번호 MI0001653
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.