
Merck MISSION Lenti microRNA, Mouse
마우스 유래 microRNA(mm-miR-7660-3p)를 발현하는 렌티바이러스 벡터 제품으로, 정확한 Dicer 처리와 효율적 유전자 발현을 위한 EF1A 프로모터를 사용합니다. 건빙 상태로 배송되며, −70°C에서 보관합니다.
- 카탈로그번호
- MLMIR1959
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA, Mouse
MISSION® Lenti microRNA, Mouse
mmu-miR-7660-3p
제품 개요
Sigma의 MISSION® Lenti-miRs는 공통 백본 구조를 기반으로 microRNA를 발현하는 렌티바이러스 시스템입니다.
정확한 Dicer 처리에 필요한 구조를 갖추고 있으며, 상보적인 부분을 모사한 설계 알고리즘을 사용합니다.
각 miRNA construct는 클로닝 후 염기서열 검증을 거쳐 생산됩니다.
제품 특징
- miRBase에서 성숙 microRNA 서열 확보
- TRC2-pLKO-puro 벡터에 microRNA 서열 클로닝
- EF1A 프로모터를 통한 안정적 발현
- Puromycin 내성 유전자 포함
- 분화된 세포 및 비분열 세포(예: 뉴런, 수지상세포)에도 효율적 감염 가능
스펙 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUCUGUAAGUGAUGGGCAAAGUA |
| Sanger 성숙/소수 수납 번호 | MIMAT0029827 |
| microRNA 수납 번호 | MI0025000 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
추가 설명
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles for mammalian cell transduction.
Polymerase II promoter (EF1A) ensures effective transcription and integration of viral DNA into host genome.
Woodchuck Hepatitis Post-Transcriptional Regulatory element enhances transgene expression.
Puromycin resistance gene enables selection of successfully transduced cells.
Lentiviral-based particles allow efficient infection and integration into differentiated and non-dividing cells.
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



