CacheBy
Merck MISSION Lenti microRNA, Human
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Human

상품 한눈에 보기

인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 가진 MISSION® Lenti 시스템 기반 제품입니다. TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증 완료. 비분열 세포 포함 다양한 세포에 안정적 발현 가능. −70°C에서 보관.

브랜드
Merck Sigma
카테고리
Vectors

Merck Sigma · Merck MISSION Lenti microRNA, Human

MISSION® Lenti microRNA, Human

hsa-miR-372-3p


제품 개요

Sigma의 MISSION® Lenti-miRs는 정확한 Dicer 처리를 위한 공통 백본 구조를 기반으로 설계된 인간 microRNA 발현용 렌티바이러스 입자입니다.
부분 상보 서열은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
각 miRNA 구성체는 TRC2-pLKO-puro 벡터에 클로닝되고, 시퀀스 검증을 거쳐 생산됩니다.


제품 사양

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 (Concentration) ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) AAAGUGCUGCGACAUUUGAGCGU
Sanger 성숙/소수 수납 번호 MIMAT0000724
microRNA 수납 번호 MI0000780
배송 상태 (Shipping) Dry Ice
저장 온도 (Storage) −70 °C

제품 설명

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.

The polymerase II promoter, elongation factor 1 alpha (EF1A), drives miRNA expression required for reverse transcription of viral RNA and integration of viral DNA into the host genome.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.

This vector also includes a puromycin resistance gene for selection of transduced cells.
Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles allow efficient infection and integration into both dividing and non-dividing cells, such as neurons and dendritic cells.

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.