
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 가진 MISSION® Lenti 시스템 기반 제품입니다. TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증 완료. 비분열 세포 포함 다양한 세포에 안정적 발현 가능. −70°C에서 보관.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA, Human
hsa-miR-372-3p
제품 개요
Sigma의 MISSION® Lenti-miRs는 정확한 Dicer 처리를 위한 공통 백본 구조를 기반으로 설계된 인간 microRNA 발현용 렌티바이러스 입자입니다.
부분 상보 서열은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
각 miRNA 구성체는 TRC2-pLKO-puro 벡터에 클로닝되고, 시퀀스 검증을 거쳐 생산됩니다.
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AAAGUGCUGCGACAUUUGAGCGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000724 |
| microRNA 수납 번호 | MI0000780 |
| 배송 상태 (Shipping) | Dry Ice |
| 저장 온도 (Storage) | −70 °C |
제품 설명
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.
The polymerase II promoter, elongation factor 1 alpha (EF1A), drives miRNA expression required for reverse transcription of viral RNA and integration of viral DNA into the host genome.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.
This vector also includes a puromycin resistance gene for selection of transduced cells.
Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles allow efficient infection and integration into both dividing and non-dividing cells, such as neurons and dendritic cells.
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|




