
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 가진 MISSION® Lenti 시스템 기반 제품입니다. TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증 완료. 비분열 세포 포함 다양한 세포에 안정적 발현 가능. −70°C에서 보관.
- 브랜드
- Merck Sigma
- 카테고리
- Vectors
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-372-3p
제품 개요
Sigma의 MISSION® Lenti-miRs는 정확한 Dicer 처리를 위한 공통 백본 구조를 기반으로 설계된 인간 microRNA 발현용 렌티바이러스 입자입니다.
부분 상보 서열은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
각 miRNA 구성체는 TRC2-pLKO-puro 벡터에 클로닝되고, 시퀀스 검증을 거쳐 생산됩니다.
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AAAGUGCUGCGACAUUUGAGCGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000724 |
| microRNA 수납 번호 | MI0000780 |
| 배송 상태 (Shipping) | Dry Ice |
| 저장 온도 (Storage) | −70 °C |
제품 설명
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.
The polymerase II promoter, elongation factor 1 alpha (EF1A), drives miRNA expression required for reverse transcription of viral RNA and integration of viral DNA into the host genome.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.
This vector also includes a puromycin resistance gene for selection of transduced cells.
Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles allow efficient infection and integration into both dividing and non-dividing cells, such as neurons and dendritic cells.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



