
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 갖춘 MISSION® Lenti 시스템 기반. TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증 완료. 비분열 세포 포함 다양한 세포에 안정적 전이 가능.
- 브랜드
- Merck Sigma
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-504-5p
제품 개요
Sigma의 MISSION® Lenti-miRs는 공통 백본 구조에서 microRNA를 발현하도록 설계된 렌티바이러스 기반 시스템입니다. 이 구조는 정확한 Dicer 처리를 보장하며, 상보적인 가닥은 독자적 알고리즘을 통해 백본의 염기쌍 패턴을 모방하도록 설계되었습니다.
각 microRNA 서열은 TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증을 거쳤으며, 성숙 microRNA 서열은 miRBase에서 확보되었습니다.
주요 특징
- TRC2-pLKO-puro 벡터 기반 microRNA 발현 시스템
- EF1A 프로모터를 이용한 안정적 발현
- Puromycin 내성 유전자 포함
- 분열 및 비분열 세포 모두에서 효율적 감염 및 통합 가능
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element(WPRE) 포함으로 발현 강화
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AGACCCUGGUCUGCACUCUAUC |
| Sanger 성숙/소수 수납 번호 | MIMAT0002875 |
| microRNA 수납 번호 | MI0003189 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70 °C |
제품 설명
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.
The polymerase II promoter, elongation factor 1 alpha (EF1A), drives miRNA expression required for reverse transcription and integration into the host genome.
This lentiviral vector also carries a puromycin resistance gene for cell selection. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles allow efficient infection and integration into both dividing and non-dividing cells such as neurons and dendritic cells.
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



