AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2Merck MISSION Lenti microRNA, Human
상품 한눈에 보기
인간 microRNA를 렌티바이러스 벡터로 발현하는 MISSION Lenti-miR 제품. 시퀀스 검증된 TRC2-pLKO-puro 벡터 기반으로 제작되며, 비분열 세포까지 효율적으로 감염 가능. EF1A 프로모터와 puromycin 내성 유전자를 포함.
- 브랜드
- Merck Sigma
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-532-5p
제품 개요
Sigma의 MISSION® Lenti-miR 제품은 공통 백본 구조에서 miRNA를 발현하도록 설계된 렌티바이러스 기반 시스템입니다.
정확한 Dicer 처리와 상보적 가닥 형성을 위한 독자적 알고리즘을 사용하여 제작되었으며, 각 miRNA는 TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증을 거쳤습니다.
이 시스템은 분열 및 비분열 세포(예: 뉴런, 수지상세포) 모두에서 효율적인 감염 및 통합을 가능하게 합니다.
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | CAUGCCUUGAGUGUAGGACCGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0002888 |
| microRNA 수납 번호 | MI0003205 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70 °C |
제품 설명
- Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
- Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
- The EF1A promoter drives miRNA expression, enabling reverse transcription and integration into the host genome.
- Contains Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element (WPRE) for enhanced expression.
- Includes a puromycin resistance gene for cell selection.
- Lentiviral-based particles allow efficient infection and integration into both dividing and non-dividing mammalian cells.
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.