CacheBy
Merck MISSION Lenti microRNA, Human
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Human

상품 한눈에 보기

인간 microRNA(hsa-miR-582-3p)를 발현하는 렌티바이러스 입자. TRC2-pLKO-puro 벡터 기반으로 제작되어 정확한 Dicer 처리 및 안정적 발현 보장. EF1A 프로모터와 puromycin 내성 유전자 포함. −70°C 보관, 드라이아이스 배송.

브랜드
Merck Sigma
카테고리
Other Organics

Merck Sigma · Merck MISSION Lenti microRNA, Human

MISSION® Lenti microRNA, Human

hsa-miR-582-3p


제품 개요

Merck Sigma의 MISSION® Lenti microRNA는 인간 microRNA를 안정적으로 발현시키는 렌티바이러스 입자입니다. 공통 백본 구조를 사용하여 Dicer 효소에 의한 정확한 처리와 효율적인 발현을 보장합니다. TRC2-pLKO-puro 벡터를 기반으로 제작되며, 각 miRNA construct는 클로닝 및 서열 검증을 완료했습니다.


주요 특징

  • 정확한 Dicer 처리 구조를 가진 공통 백본 사용
  • TRC2-pLKO-puro 벡터 기반
  • EF1A 프로모터에 의해 miRNA 발현 유도
  • Puromycin 내성 유전자 포함
  • Lentiviral 시스템으로 분화된 세포 및 비분열 세포 감염 가능

스펙 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 UAACUGGUUGAACAACUGAACC
Sanger 성숙/소수 수납 번호 MIMAT0004797
microRNA 수납 번호 MI0003589
배송 상태 Dry ice
저장 온도 −70°C

상세 설명

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles capable of transducing mammalian cells.

EF1A polymerase II promoter drives miRNA expression for reverse transcription and integration into the host genome. The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression. The lentiviral vector includes a puromycin resistance gene for cell selection.

Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles enable efficient infection and integration into both differentiated and non-dividing cells, such as neurons and dendritic cells.


제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.