
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2Merck MISSION Lenti microRNA, Mouse
상품 한눈에 보기
마우스 유래 microRNA를 렌티바이러스 기반으로 발현하는 MISSION Lenti-miR 제품. TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증 완료. 비분열 세포 포함 다양한 세포주 감염 가능. 건빙 상태로 배송, -70°C 보관.
- 브랜드
- Merck Sigma
- 카테고리
- Vectors
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
카탈로그 번호 · 상품 설명출고판매가담기
ADADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기Merck MLMIR2020 MISSION Lenti microRNA, Mouse, pk판매 단위 pk
재고 확인 필요
견적요청
Merck Sigma · Merck MISSION Lenti microRNA, Mouse
MISSION® Lenti microRNA, Mouse
mmu-miR-8091
제품 개요
Sigma의 MISSION® Lenti-miRs는 공통 백본 구조에서 유래된 miRNA를 발현하도록 설계된 렌티바이러스 입자입니다.
정확한 Dicer 처리 요구사항을 충족하며, 상보적 가닥은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
각 miRNA는 TRC2-pLKO-puro 벡터에 클로닝되어 시퀀스 검증을 거쳤습니다.
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태(Form) | Liquid |
| 농도(Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열(Mature Sequence) | AGGAGUGAGUGGUAAGCUGGUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0031392 |
| microRNA 수납 번호 | MI0026018 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
- Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
- Lentiviral transduction particles are produced from sequence-verified plasmid vectors.
- Co-transfection with compatible packaging plasmids enables production of viral particles for mammalian cell transduction.
- EF1A (Elongation Factor 1 alpha) promoter drives miRNA expression for reverse transcription and integration into the host genome.
- Contains Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression.
- Carries a puromycin resistance gene for cell selection.
- Suitable for infection and integration into both dividing and non-dividing cells (e.g., neurons, dendritic cells).
- Superior to murine-based retroviral systems (MMLV, MSCV) for transduction efficiency and stability.
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



