CacheBy
Merck MISSION Lenti microRNA, Human
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Human

상품 한눈에 보기

인간 microRNA 발현용 렌티바이러스 벡터로, TRC2-pLKO-puro 백본 기반의 MISSION® Lenti 시스템을 사용합니다. 시퀀스 검증 완료된 miRNA를 안정적으로 발현하며, 비분열 세포에서도 효율적인 감염 및 통합이 가능합니다. −70°C 보관, 드라이아이스 배송.

브랜드
Merck Sigma
카테고리
Cell Manipulation

Merck Sigma · Merck MISSION Lenti microRNA, Human

MISSION® Lenti microRNA, Human

hsa-miR-6821-5p


제품 개요

Sigma의 MISSION® Lenti-miRs는 공통 백본에서 microRNA를 발현하도록 설계된 렌티바이러스 시스템입니다.
정확한 Dicer 처리 요건을 충족하며, 독자 알고리즘으로 설계된 상보 가닥을 포함하여 안정적인 발현을 보장합니다.
각 microRNA 서열은 miRBase에서 확보되며, TRC2-pLKO-puro 벡터에 클로닝 후 시퀀스 검증을 거쳐 생산됩니다.


주요 특징

  • TRC2-pLKO-puro 벡터 기반의 렌티바이러스 시스템
  • EF1A 프로모터를 사용하여 안정적인 miRNA 발현
  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element(WPRE) 포함으로 발현 향상
  • 퓨로마이신 내성 유전자 포함
  • 비분열 세포(예: 뉴런, 수지상세포)에서도 효율적 감염 및 통합 가능

제품 사양

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 (Concentration) ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) GUGCGUGGUGGCUCGAGGCGGGG
Sanger 성숙/소수 수납 번호 MIMAT0027542
microRNA 수납 번호 MI0022666
배송 상태 (Shipping Condition) Dry ice
보관 온도 (Storage Temperature) −70°C

상세 설명

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The EF1A promoter drives miRNA expression necessary for reverse transcription and genomic integration.
Additionally, the WPRE element enhances expression of transgenes delivered by lentiviral vectors.
This vector carries a puromycin resistance gene for selection.
Unlike murine-based retroviral systems (MMLV, MSCV), lentiviral-based particles enable efficient infection and integration into both dividing and non-dividing cells.


제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.