
Merck MISSION Lenti microRNA, Human
인간 miRNA hsa-miR-625-5p를 발현하는 렌티바이러스 기반 MISSION® Lenti microRNA 제품. 정확한 Dicer 처리 구조를 갖춘 TRC2-pLKO-puro 벡터 기반. 건조 얼음 배송, −70°C 보관. 비분열 세포에서도 효율적 전이 가능.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA, Human
hsa-miR-625-5p
제품 개요
Sigma의 MISSION® Lenti-miRs는 공통 백본 구조에서 miRNA를 발현하며, Dicer 처리 정확도를 만족하도록 설계되었습니다. 부분 상보적 가닥은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 디자인되었습니다.
Oligos containing microRNA sequences are cloned into the TRC2-pLKO-puro vector, and each construct is sequence verified. Mature microRNA sequences are obtained from miRBase.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Co-transfection of these vectors with compatible packaging plasmids enables production of viral particles that can transduce mammalian cells.
EF1A polymerase II promoter drives miRNA expression for reverse transcription and genome integration. The Woodchuck Hepatitis Post-Transcriptional Regulatory element enhances transgene expression, and the vector includes a puromycin resistance gene for selection.
Unlike murine MMLV or MSCV retroviral systems, lentiviral particles allow efficient infection and integration into differentiated and non-dividing cells such as neurons and dendritic cells.
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AGGGGGAAAGUUCUAUAGUCC |
| Sanger 성숙/소수 수납 번호 | MIMAT0003294 |
| microRNA 수납 번호 | MI0003639 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|




