CacheBy
Merck MISSION Lenti microRNA, Human
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA, Human

상품 한눈에 보기

인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 갖춘 MISSION® 백본 기반. TRC2-pLKO-puro 벡터에 클로닝되어 서열 검증 완료. 비분열 세포 포함 다양한 세포 감염 가능하며, 퓨로마이신 내성 유전자 포함.

브랜드
Merck Sigma
카테고리
Vectors

Merck Sigma · Merck MISSION Lenti microRNA, Human

MISSION® Lenti microRNA, Human

hsa-miR-4659b-3p


제품 개요

Sigma의 MISSION® Lenti-miRs는 공통 백본 구조를 기반으로 하여 정확한 Dicer 처리를 보장하도록 설계된 인간 microRNA 발현용 렌티바이러스 입자입니다.
부분 상보적 서열은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
microRNA 서열은 TRC2-pLKO-puro 벡터에 클로닝되며, 각 구성체는 클로닝 및 서열 검증을 거쳤습니다. 성숙 microRNA 서열은 miRBase에서 확보됩니다.


제품 사양

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 (Concentration) ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 (Mature Sequence) UUUCUUCUUAGACAUGGCAGCU
Sanger 성숙/소수 수납 번호 MIMAT0019734
microRNA 수납 번호 MI0017291
배송 상태 (Shipping Condition) Dry ice
저장 온도 (Storage Temperature) −70°C

제품 설명

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles used to transduce mammalian cells.

EF1A (Elongation Factor 1 Alpha) promoter drives miRNA expression necessary for reverse transcription and integration into the host genome.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for selection of transduced cells.

Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles enable efficient infection and stable integration of miRNA constructs into both dividing and non-dividing cells, such as neurons and dendritic cells.


제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.