
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 갖춘 MISSION® 백본 기반. TRC2-pLKO-puro 벡터에 클로닝되어 서열 검증 완료. 비분열 세포 포함 다양한 세포 감염 가능하며, 퓨로마이신 내성 유전자 포함.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA, Human
hsa-miR-4659b-3p
제품 개요
Sigma의 MISSION® Lenti-miRs는 공통 백본 구조를 기반으로 하여 정확한 Dicer 처리를 보장하도록 설계된 인간 microRNA 발현용 렌티바이러스 입자입니다.
부분 상보적 서열은 독자 알고리즘을 통해 백본 구조의 염기쌍 패턴을 모방하도록 설계되었습니다.
microRNA 서열은 TRC2-pLKO-puro 벡터에 클로닝되며, 각 구성체는 클로닝 및 서열 검증을 거쳤습니다. 성숙 microRNA 서열은 miRBase에서 확보됩니다.
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UUUCUUCUUAGACAUGGCAGCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0019734 |
| microRNA 수납 번호 | MI0017291 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors.
Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles used to transduce mammalian cells.
EF1A (Elongation Factor 1 Alpha) promoter drives miRNA expression necessary for reverse transcription and integration into the host genome.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for selection of transduced cells.
Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles enable efficient infection and stable integration of miRNA constructs into both dividing and non-dividing cells, such as neurons and dendritic cells.
제품 이미지
(이미지 없음)
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|




